lelgenio to Memes · 1 year agoAACGTCATAGCCTGATTACCAGTAGGTACTAGimagemessage-square12fedilinkarrow-up1454arrow-down127file-text
arrow-up1427arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlelgenio to Memes · 1 year agomessage-square12fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squarecapy_bara@lemmy.worldlinkfedilinkarrow-up2·1 year agoThere is also epigenetic modifications to be considered
minus-squareMininux@sh.itjust.workslinkfedilinkarrow-up1·1 year agoOh cool I didn’t know that stuff, it’s super interesting
There is also epigenetic modifications to be considered
Oh cool I didn’t know that stuff, it’s super interesting